Inactive p53 mutants may enhance the transcriptional activity of wild-type p53.

نویسندگان

  • W Zhang
  • J W Shay
  • A Deisseroth
چکیده

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Wild Type p53 Gene Transfer Increases Chemosensitivity and Apoptotic Response of PANC-1 Pancreatic Tumor Cell Line

The effect of p53 gene therapy on chemosensitivity and apoptotic response of PANC-1 tumor cells, which express high amount of mutant p53, to cancer chemotherapeutic agents of Etoposide and Doxorubicin was investigated. Comparison of the chemosensitivity of PANC-1 cells to its wild type p53 transfectants showed that wt-p53 expressing transfectants are more sensitive to both Etoposide and Doxorub...

متن کامل

The Effect of Wild Type P53 Gene Transfer on Growth Properties and Tumorigenicity of PANC-1 Tumor Cell Line

The p53 protein function is essential for the maintenance of the nontumorigenic cell phenotype. Pancreatic tumor cells show a very high frequency of p53 mutation. To determine if restoration of wild type p53 function can be used to eliminate the tumorigenic phenotype in these cells, pancreatic tumor cell lines, PANC-1 and HTB80, differing in p53 status were stably transfected with exogenous wil...

متن کامل

p53 Oligomerization is essential for its C-terminal lysine acetylation.

Acetylation of multiple lysine residues in the p53 plays critical roles in the protein stability and transcriptional activity of p53. To better understand how p53 acetylation is regulated, we generated a number of p53 mutants and examined acetylation of each mutant in transfected cells. We found that p53 mutants that are defective in tetramer formation are also defective in C-terminal lysine re...

متن کامل

p53 modulates homologous recombination by transcriptional regulation of the RAD51 gene.

DNA repair by homologous recombination is involved in maintaining genome stability. Previous data report that wild-type p53 suppresses homologous recombination and physically interacts with Rad51. Here, we show the in vivo binding of wild-type p53 to a p53 response element in the promoter of Rad51 and the downregulation of Rad51 messenger RNA and protein by wild-type p53, favoured by DNA damage...

متن کامل

p73 function is inhibited by tumor-derived p53 mutants in mammalian cells.

The p53 tumor suppressor protein, found mutated in over 50% of all human tumors, is a sequence-specific transcriptional activator. Recent studies have identified a p53 relative, termed p73. We were interested in determining the relative abilities of wild-type and mutant forms of p53 and p73alpha and -beta isoforms to transactivate various p53-responsive promoters. We show that both p73alpha and...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Cancer research

دوره 53 20  شماره 

صفحات  -

تاریخ انتشار 1993